Base de dados : LILACS
Pesquisa : C01.539.221.750 [Categoria DeCS]
Referências encontradas : 21 [refinar]
Mostrando: 1 .. 10   no formato [Detalhado]

página 1 de 3 ir para página          

  1 / 21 LILACS  
              next record last record
seleciona
para imprimir
Fotocópia
Texto completo SciELO Brasil
Texto completo
Id: biblio-1014595
Autor: Peranovich, Andrés.
Título: Enfermedades transmitidas por el agua en Argentina y Brasil a principios del siglo XXI / Waterborne diseases in Argentina and Brazil at the beginning of the 21st century
Fonte: Saúde Soc;28(2):297-309, abr.-jun. 2019. tab, graf.
Idioma: es.
Resumo: Resumen Este artículo pretende analizar la evolución de la mortalidad por enfermedades transmitidas por el agua durante el primer decenio del siglo XXI, por grupos de edades, comparando dos países del cono sur: Argentina y Brasil. Se estiman Años de Esperanza de Vida Perdidos (AEVP) por causa de muerte en base a la técnica descripta por Eduardo Arriaga. Para todas las estimaciones de defunción se utilizan promedios móviles para establecer dos períodos: 2000-2002 y 2009-2011. Se observa una tendencia general a la disminución de la mortalidad por enfermedades relacionadas con el agua, tanto en Argentina como en Brasil, con una velocidad de reducción promedio de los años de vida perdidos cercana al 1% anual. Esta reducción no es uniforme para todas las enfermedades relacionadas a este grupo de causas; de hecho existen causas que aumentan su mortalidad en el período estudiado, aunque en su mayoría se trata de brotes epidémicos. Por otro lado, el grupo de causas analizado impacta más en las edades más vulnerables: los menores de 1 año y los mayores de 50 años. Las intervenciones aisladas que se hacen sobre la higiene del agua, no logran por sí solas alcanzar los niveles de éxito deseado frente a este tipo de afecciones, que dependen de otros factores asociados a las condiciones de salud, la calidad de vida y la educación sanitaria.

Abstract This article aims at analyzing the evolution of mortality from waterborne diseases during the first decade of the 21st century, by age groups, comparing two countries of the southern cone: Argentina and Brazil. The method of years of potential life lost (YPLL) due to death, based on the technique described by Eduardo Arriaga, was used. For all death estimates, moving averages are used to establish two periods: 2000-2002 and 2009-2011. There is a general trend towards a reduction in mortality because of water-related diseases, both in Argentina and Brazil, with an average reduction rate of years of life lost close to 1% per year. This reduction is not uniform for all diseases related to this group of causes; in fact, there are causes that increase their mortality in the period studied, although most are epidemic outbreaks. On the other hand, the group of causes analyzed impacts more on the most vulnerable ages: those under 1 year old and those over 50 years old. The isolated interventions made on the hygiene of the water do not reach the levels of desired success by themselves considering this type of affections, that depend on other factors associated to the health conditions, the quality of life and the health education.
Descritores: Controle da Qualidade da Água
Educação em Saúde
Surtos de Doenças
Mortalidade
Purificação da Água
Doenças Transmitidas pela Água
Limites: Seres Humanos
Masculino
Feminino
Responsável: BR67.1 - CIR - Biblioteca - Centro de Informação e Referência


  2 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
Id: biblio-912759
Autor: Araujo, Ronalda Silva de.
Título: Quantificação e caracterização genotípica de Cryptosporidium spp. isolados de água bruta superficial e esgoto bruto para a monitorização em mananciais de abastecimento público na Região Metropolitana de São Paulo (RMSP) / Quantification and molecular characterization of Cryptosporidium spp. from raw surface water and raw sewage for the monitoring of public water supply sources in the metropolitan region of São Paulo.
Fonte: São Paulo; s.n; 2015. 130 p.
Idioma: pt.
Tese: Apresentada a Universidade de São Paulo. Faculdade de Saúde Pública. Departamento Serviços de Saúde Pública para obtenção do grau de Doutor.
Resumo: As doenças de veiculação hídrica, sobretudo aquelas causadas por protozoários intestinais, emergiram como um dos principais problemas de saúde pública. Diferentes aspectos são abordados sobre a biologia e a epidemiologia dos principais protozoários parasitas de transmissão hídrica. Cryptosporidium está descrito como um importante parasita associado a casos de surtos de veiculação hídrica e alimentos no mundo. A epidemiologia complexa desse protozóario e o fato de que a maioria das espécies e genótipos não pode ser diferenciada morfologicamente, aumentam o interesse por metodologias sensíveis e rápidas na detecção de espécies responsáveis pela infecção em humanos. Neste estudo foram avaliadas 50 amostras de água bruta superficial, coletadas no Rio São Lourenço da Serra (P1A) e Represa de Guarapiranga (P2A) e 50 de esgoto bruto coletadas em São Lourenço da Serra (P1E) e no poço vertical de Taboão da Serra (P2E) entre os meses de janeiro e dezembro de 2013. O isolamento dos oocistos na água foi realizado pelo Método 1623.1 e as amostras de esgoto bruto por centrifugação, separação imunomagnética (IMS). A caracterização genotípica ocorreu por meio da nested PCR, clonagem e sequenciamento com base no gene 18S rRNA comum a todas as espécies de Cryptosporidium. O ensaio de PCR em tempo real (qPCR) foi avaliado simultaneamente para detecção e quantificação de oocistos nas amostras. De acordo com os resultados obtidos pela nested PCR, Cryptosporidium foi detectado na água bruta superficial em 12 por cento (3/25) no manancial P1A e 16 por cento (4/25) no P2A. No esgoto bruto o parasito foi detectado em 20 por cento (5/25) das amostras no ponto P1E e 24 por cento (6/25) no poço vertical P2E. A qPCR detectou 52 por cento (0,79 a 1,85 oocistos/L) de amostras positivas no manancial P1A e o parasito foi detectado em 64 por cento (0,72 a 1,4 oocistos/L) no manancial P2A. No esgoto bruto 72 por cento das amostras foram positivas tanto no ponto P1E (7 a 655 oocistos/L) como no P2E (5 a 519 oocistos/L). A caracterização molecular permitiu a identificação de C. parvum e C. hominis na água bruta superficial, e C. hominis, C. parvum, e C. muris no esgoto bruto. As espécies do gênero Cryptosporidium identificadas neste estudo apresentam expressiva relevância para o desenvolvimento da doença humana. Neste sentido, as metodologias de concentração e caracterização empregadas nas análises demonstraram no geral, o potencial para aplicação em estudos de vigilância ambiental e foram úteis na diferenciação de espécies patogênicas. A presença de C. muris associada às espécies antroponóticas identificadas auxiliou na investigação de prováveis fontes de contaminação no ambiente confirmando a necessidade da expansão de medidas efetivas para proteção destes mananciais.

Waterborne diseases, especially those caused by intestinal protozoa, have emerged as a major public health problem. Different aspects are addressed on the biology and epidemiology of most waterborne protozoan parasites. Cryptosporidium is described as an important parasite associated with cases of waterborne and food outbreaks in the world. The complex epidemiology of this protozoan, as well as the fact that most species and genotypes cannot be differentiated morphologically, increase the interest for sensitive and rapid methods for the detection of species responsible for infection in humans. In this study, 50 samples of raw surface water were collected from São Lourenço River (P1A) and Guarapiranga Dam (P2A), and 50 samples of raw sewage were collected from São Lourenço da Serra (P1E) and from Taboão da Serras vertical well (P2E), between January and December of 2013. The isolation of oocysts in water was carried out by the USEPA Method 1623.1 and raw sewage samples were processed by centrifugation, immunomagnetic separation (IMS). Genotypic characterization occurred by nested PCR, cloning and sequencing based on 18S rRNA gene, which is common to all Cryptosporidium species. Real time PCR assays (qPCR) were carried out both for detection and quantification of oocysts simultaneously in the samples. According to the results obtained by nested PCR, Cryptosporidium was detected in raw surface water in 12 per cent (3/25) of samples at P1A and in 16 per cent (4/25) at P2A. In raw sewage the parasite was detected in 20 per cent (5/25) of samples at P1E and 24 per cent (6/25) in P2E vertical well. qPCR detected 52 per cent (0.79 to 1.85 oocysts/L) of positive samples at P1A, while the parasite was detected in 64 per cent (0.72 to 1.4 oocysts/L) of samples at P2A water supply. Regarding raw sewage, 72 per cent of samples were positive both at P1E (7 to 655 oocysts/L) and P2E (5 to 519 oocysts/L Molecular characterization allowed the identification of C. parvum and C. hominis in raw surface water, and C. hominis, C. parvum and C. muris in raw sewage. Cryptosporidium species identified herein belong to a group of organisms of significant relevance in waterborne diseases. Therefore, concentration and characterization methodologies applied in our analyses showed to be useful for environmental surveillance studies, as well as they were useful in the differentiation of human pathogens. The presence of C. muris associated to anthroponotic species helped in the investigation of likely contamination sources in the environment, confirming the need of expansion in effective measures to protect these water supplies.
Descritores: Cryptosporidium/genética
Técnicas de Genotipagem/métodos
Análise Microbiológica
SPRINGS
Abastecimento de Água
-Reação em Cadeia da Polimerase
Microbiologia da Água
Doenças Transmitidas pela Água/prevenção & controle
Responsável: BR67.1 - CIR - Biblioteca - Centro de Informação e Referência
BR67.1; DR1204; BR67.1; DR1204


  3 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
Id: biblio-868417
Autor: Galvani, Ana Tereza.
Título: Quantificação de oocistos de Toxoplasma gondii em amostras de águas superficiais no Estado de São Paulo / Quantification of Toxoplasma gondii oocysts in surface water samples in São Paulo.
Fonte: São Paulo; s.n; 2016. 84 p.
Idioma: pt.
Tese: Apresentada a Universidade de São Paulo. Faculdade de Saúde Pública. Departamento de Saúde Ambiental para obtenção do grau de Mestre.
Resumo: Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo

Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo
Descritores: Oócitos
Toxoplasma
Análise da Água
Abastecimento de Água
-DNA
Reação em Cadeia da Polimerase
Doenças Transmitidas pela Água
Responsável: BR67.1 - CIR - Biblioteca - Centro de Informação e Referência
BR67.1; MTR2228


  4 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
Id: lil-786778
Autor: Winckler, Leonardo Zamae; Santos, Ricardo Martins; Ferreira, Milena Wolff; Santos, Filipe Martins; Leite, Tereza Cristina; Andrade, Gisele Braziliano de.
Título: Mortalidade de tambacus (Colossoma macropomum x Piaractus mesopotamicus) infectados por Edwardsiella tarda / Mortality of tambacus (Colossoma macropomum x Piaractus mesopotamicus) infected by Edwardsiella tarda
Fonte: Braz. j. vet. res. anim. sci;52(1):63-67, abr. 2015. ilus.
Idioma: pt.
Resumo: O presente trabalho relata um surto de mortalidade de tambacus (Colossoma macropomum x Piaractus mesopotamicus) criados em tanques escavados da Fazenda-Escola da UCDB. Os peixes apresentaram sintomas clínicos de letargia, anorexia, aumento da produção de muco, nado desordenado e comportamento de buscar a superfície da água. Ao exame necroscópico de três peixes foram evidenciadas hemorragias nas nadadeiras e pele, opacidade de córnea, hemoperitôneo, distensão e repleção da vesícula biliar e congestão e hemorragia do tubo digestivo. O exame microbiológico dos materiais coletados das lesões dos tambacus foi positivo para a bactéria Edwardsiella tarda. A análise de qualidade de água indicou grande quantidade de fitoplânctons que proliferaram em função do excesso de matéria orgânica, caracterizando a eutrofização da água. Atribuiu-se a causa da morte dos tambacus à infecção oportunista pela E. tarda, favorecida pelo desequilíbrio devido ao excesso de matéria orgânica em suspensão na água. As mortes cessaram após a correção dos parâmetros da qualidade da água do tanque.

An outbreak of mortality of tambacus (Colossoma macropomum x Piaractus mesopotamicus) cultivated in dug tanks at UCDB was reported. Animals had clinical surface symptoms of lethargy, anorexia, increased mucus production, cluttering and swimming toward the water. Macroscopic examination of three fishes showed hemorrhages of the fins and skin, corneal opacity, hemoperitoneum, gallbladder distension and repletion, congestion and hemorrhages of the digestive tract. Water quality analysis indicated large amounts of phytoplankton that proliferated as a result of the excessive organic matter causing eutrophication of the water. The microbiological examination of tambacus lesions revealed the presence of the bacterium Edwardsiella tarda. The cause of the tambacus death was attributed to opportunistic infection by E. tarda, favored by the imbalance due to the intense organic matter in suspended in the water. Deaths stopped after the correction of the water quality parameters.
Descritores: Characidae/microbiologia
Edwardsiella tarda/isolamento & purificação
Edwardsiella tarda/patogenicidade
-Eutrofização
Doenças Transmitidas pela Água
Limites: Animais
Responsável: BR68.1 - Biblioteca Virginie Buff D'Ápice


  5 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo SciELO Brasil
Reiche, Edna Maria Vissoci
Texto completo
Id: lil-770113
Autor: CAPOBIANGO, Jaqueline Dario; MITSUKA-BREGANÓ, Regina; MONICA, Thais Cabral; FERREIRA, Fernanda Pinto; REICHE, Edna Maria Vissoci.
Título: ACUTE TOXOPLASMOSIS IN A BREASTFED INFANT WITH POSSIBLE TRANSMISSION BY WATER / Toxoplasmose aguda em um lactente durante a amamentação, com possível transmissão pela água
Fonte: Rev. Inst. Med. Trop. Säo Paulo;57(6):523-526, Nov.-Dec. 2015. tab, graf.
Idioma: en.
Resumo: Toxoplasma gondii transmission via breastfeeding has been discussed; however, no cases have been confirmed to date. This article describes a case of acute toxoplasmosis diagnosed in a mother and her six-month-old breastfed infant. The study accounts for the possibility of breast milk transmission and directs both clinicians and pediatricians to the hypothesis that both patients acquired toxoplasmosis via water ingestion.

A transmissão do Toxoplasma gondii através do aleitamento materno tem sido discutida; no entanto, até o momento nenhum caso foi confirmado. Este artigo relata um caso de toxoplasmose aguda diagnosticada na mãe e no seu bebê com seis meses de vida, que estava em amamentação exclusiva. Embora apresente a possibilidade de transmissão pelo leite materno, o estudo chama a atenção de clínicos e pediatras para a mais provável hipótese de que ambos adquiriram toxoplasmose pela ingestão de água.
Descritores: Aleitamento Materno
Água Potável/parasitologia
Leite Humano/parasitologia
Toxoplasmose/transmissão
Doenças Transmitidas pela Água/parasitologia
-Afinidade de Anticorpos
Brasil
Reação em Cadeia da Polimerase
Toxoplasma/isolamento & purificação
Limites: Feminino
Seres Humanos
Lactente
Tipo de Publ: Relatos de Casos
Responsável: BR1.1 - BIREME


  6 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo SciELO Brasil
Texto completo
Id: lil-764583
Autor: Vieira, Flávia Pereira; Alves, Maria da Glória; Martins, Livia Mattos; Rangel, Alba Lucínia Peixoto; Dubey, Jitender Prakash; Hill, Dolores; Bahia-Oliveira/, Lilian Maria Garcia.
Título: Waterborne toxoplasmosis investigated and analysed under hydrogeological assessment: new data and perspectives for further research
Fonte: Mem. Inst. Oswaldo Cruz;110(7):929-935, Nov. 2015. tab, graf.
Idioma: en.
Projeto: FAPERJ; . FAPERJ; . FAPERJ; . CAPES.
Resumo: We present a set of data on human and chicken Toxoplasma gondiiseroprevalence that was investigated and analysed in light of groundwater vulnerability information in an area endemic for waterborne toxoplasmosis in Brazil. Hydrogeological assessment was undertaken to select sites for water collection from wells for T. gondiioocyst testing and for collecting blood from free-range chickens and humans for anti-T. gondiiserologic testing. Serologic testing of human specimens was done using conventional commercial tests and a sporozoite-specific embryogenesis-related protein (TgERP), which is able to differentiate whether infection resulted from tissue cysts or oocysts. Water specimens were negative for the presence of viable T. gondiioocysts. However, seroprevalence in free-range chickens was significantly associated with vulnerability of groundwater to surface contamination (p < 0.0001; odds ratio: 4.73, 95% confidence interval: 2.18-10.2). Surprisingly, a high prevalence of antibodies against TgERP was detected in human specimens, suggesting the possibility of a continuous contamination of drinking water with T. gondiioocysts in this endemic setting. These findings and the new proposed approach to investigate and analyse endemic toxoplasmosis in light of groundwater vulnerability information associated with prevalence in humans estimated by oocyst antigens recognition have implications for the potential role of hydrogeological assessment in researching waterborne toxoplasmosis at a global scale.
Descritores: Galinhas/parasitologia
Água Doce/parasitologia
Oocistos
Toxoplasma/imunologia
Toxoplasmose/epidemiologia
Doenças Transmitidas pela Água/epidemiologia
-Anticorpos Antiprotozoários/sangue
Antígenos de Protozoários/análise
Brasil/epidemiologia
Ensaio de Imunoadsorção Enzimática
Proteínas de Protozoários/análise
Estudos Soroepidemiológicos
Toxoplasma/isolamento & purificação
Toxoplasmose Animal/diagnóstico
Toxoplasmose Animal/epidemiologia
Toxoplasmose/diagnóstico
Toxoplasmose/transmissão
Doenças Transmitidas pela Água/diagnóstico
Doenças Transmitidas pela Água/transmissão
Limites: Adolescente
Adulto
Idoso
Idoso de 80 Anos ou mais
Animais
Criança
Feminino
Seres Humanos
Masculino
Meia-Idade
Adulto Jovem
Tipo de Publ: Research Support, Non-U.S. Gov't
Research Support, U.S. Gov't, Non-P.H.S.
Responsável: BR1.1 - BIREME


  7 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Id: lil-756811
Autor: Caldeira, Juliana Viana.
Título: Índice de sensibilidade ao risco de contrair doenças infecciosas de veiculação hídrica (Hepatite A, Leptospirose e Esquistossomose) na Área de Influência da Estação de Tratamento de Esgoto – ETE Alegria, no Município do Rio de Janeiro / Sensitivity index to the risk of contracting infectious waterborne diseases (hepatitis A, leptospirosis and schistosomiasis) in the Area of Influence of Sewage Treatment Station - ETE Joy, in the city of Rio de Janeiro.
Fonte: Rio de Janeiro; s.n; 2014. x,113 p. ilus, mapas, tab, graf.
Idioma: pt.
Tese: Apresentada a Escola Nacional de Saúde Pública Sergio Arouca para obtenção do grau de Mestre.
Resumo: Este trabalho objetivou analisar a relação entre a vulnerabilidade social e o número de casos existentes de doenças infecciosas relacionadas à água, frente às alterações climáticas (enchentes, deslizamentos, etc.), a partir da identificação de áreas sensíveis ao risco de desenvolver estas doenças. Para isto definiu-se como área de estudo as RAs que são beneficiadas pelos serviços de coleta e tratamento de esgotos da ETE Alegria, consideradas umas das principais obras de infraestrutura sanitária do Programa de Despoluição da Baía de Guanabara - PDBG. Foram analisadas um total de 12 RAs, na série histórica de 2000 a 2009, quanto as variáveis epidemiológica (número de casos existentes e frequência de ocorrência na população); climatológica (precipitação, dias de chuva, temperatura máxima e mínima) e socioeconômica (educação, renda, distribuição de água, destino do lixo e esgotamento sanitário). Ao final desta caracterização, construiu-se um Índice de Sensibilidade ao Risco (ISR) para doenças infecciosas de veiculação hídrica, com base na metodologia proposta por De Oliveira (2013). A partir dos resultados obtidos neste trabalho foi possível classificar as RAs que compõem a área de influência da ETE Alegria em três níveis de risco: baixo (Portuária e Centro), médio (Rio Comprido, São Cristóvão, Tijuca, Vila Isabel, Inhaúma, Méier, Jacarezinho, Complexo do Alemão e Complexo da Maré) e alto (Ramos). Dentre as componentes do ISR, a que mais influenciou a ocorrência de doenças infecciosas de veiculação hídrica foi o indicador socioeconômico, principalmente relacionado às variáveis renda, esgotamento sanitário e coleta de lixo...

This paper aims to analyze the relationship between social vulnerability and prevalence of infectious diseases related to water, face to climate change ( floods, landslides , etc.), from the identification of sensitive areas to developing these diseases . To this, the study area was defined by the administrative regions (RA in portuguese) which are benefited by the services of collection and treatment of sewage from ETE Alegria , considered one of the major works of the health infrastructure program to clean the Guanabara Bay - PDBG . A total of twelve RAs were analyzed in the time series from 2000 to 2009, as epidemiological variables ( prevalence of cases ); climatological (precipitation, rainy days, maximum and minimum temperature ) and socioeconomic ( education, income , water supply , garbage and sewage ). At the end of this characterization we constructed an Index of Sensitivity Risk (ISR ) for infectious diseases related to water, based on the methodology proposed by De Oliveira (2013). From the results obtained in this work, it was possible to classify the RAs that comprise the area of influence of ETE Alegria into three risk levels: low (Portuária and Centro) , medium (Rio Comprido, São Cristóvão, Tijuca, Vila Isabel, Inhaúma, Méier, Jacarezinho, Complexo do Alemão e Complexo da Maré) and high (Ramos) . Among the components of the ISR, who most influences of prevalence of infectious waterborne diseases is the socioeconomic index, primarily related to income variables, sewage and garbage collection. Still, considering the results presented by RA, this study showed, according to the methodology used, even in areas where the epidemiological risk is not high Index of Sensitivity to Risk can be classified as high or medium, mainly due to socioeconomic conditions found, the vulnerability of the area for the occurrence of extreme events and due to under reporting...
Descritores: Mudança Climática
Epidemiologia/estatística & dados numéricos
Redes de Esgoto
Vulnerabilidade Social
Doenças Transmitidas pela Água
-Inundações
Deslizamentos de Terra
Fatores de Risco
Limites: Seres Humanos
Tipo de Publ: Estudo Comparativo
Responsável: BR526.1 - Biblioteca de Saúde Pública


  8 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Id: lil-756790
Autor: Patz, Jonathan A; Christenson, Megan.
Título: A mudança climática e a saúde / Climate change and health
Fonte: In: Galvão, Luiz Augusto C; Finkelman, Jacobo; Henao, Samuel. Determinantes ambientais e sociais da saúde. Rio de Janeiro, Opas; Editora Fiocruz, 2011. p.215-232, mapas, tab, graf.
Idioma: pt.
Descritores: Doenças Transmissíveis
Dengue
Inundações
Doenças Transmitidas por Alimentos
Leishmaniose Visceral
Desnutrição
Mudança Climática/estatística & dados numéricos
Temperatura Extrema
Populações Vulneráveis
Doenças Transmitidas pela Água
-Acidificação
Poluição do Ar
Efeitos do Clima
Doença Ambiental
Aquecimento Global
Prevenção e Mitigação
Limites: Seres Humanos
Tipo de Publ: Bibliografia
Responsável: BR526.1 - Biblioteca de Saúde Pública


  9 / 21 LILACS  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo SciELO Saúde Pública
Texto completo
Id: lil-752143
Autor: Guedes, Gilvan Ramalho; Simão, Andréa Branco; Dias, Carlos Alberto; Braga, Eliza de Oliveira.
Título: Risco de adoecimento por exposição às águas do Rio Doce: um estudo sobre a percepção da população de Tumiritinga, Minas Gerais, Brasil / Risk of contamination from exposure to Rio Doce water: a case study on the population’s perceptions in Tumiritinga, Minas Gerais State, Brazil / Riesgo de enfermedades por la exposición a las aguas del Río Doce: un estudio sobre la percepción de la población de Tumiritinga, Minas Gerais, Brasil
Fonte: Cad. saúde pública = Rep. public health;31(6):1257-1268, 06/2015. tab.
Idioma: pt.
Projeto: FAPEMIG; . FAPEMIG; . CNPq.
Resumo: A forte relação das pessoas com o Rio Doce, bem como suas enchentes regulares, representam fator contínuo de exposição ao risco de doenças hídricas. Dada sua relevância epidemiológica, este estudo analisa a associação entre percepção de contaminação e uso do rio, bem como os mecanismos heurísticos empregados na formação da percepção de risco. Utilizou-se um modelo probit ordenado com variável instrumental e análise de redes temáticas aplicados a uma base de dados primária de 352 domicílios, representativa dos moradores de Tumiritinga, Minas Gerais, Brasil, para o ano de 2012. Os resultados indicam que embora a maioria (92,6%) dos moradores de Tumiritinga perceba o risco de contrair algum tipo de doença quando nada no Rio Doce, somente 11,4% informam não entrar na água. A análise de conteúdo sugere que esse paradoxo advém da falta de compreensão populacional sobre os mecanismos de transmissão de doenças hídricas, criando viés otimista sobre as chances de contaminação. Campanhas para promoção de comportamento preventivo devem, portanto, enfatizar as formas de contrair doenças hídricas na região.

The close relationship between local residents and the Rio Doce and the river’s recurrent flooding lead to continuous exposure of the population to waterborne diseases. Given the epidemiological importance of such diseases in the region, this study analyzes the association between risk perception of contamination and river water use, as well as the heuristic mechanisms used by individuals to shape their personal perception of risk. Regression models coupled with thematic network analysis were applied to primary data from 352 households in 2012. The data are representative of urban residents of Tumiritinga, Minas Gerais State, Brazil. The results show that while 92.6% of respondents perceived high risk of waterborne diseases, only 11.4% reported not making direct use of the river. This apparent paradox is explained by the lack of information on transmission mechanisms, underestimating the perception of contamination. Public campaigns to promote preventive behavior should stress how waterborne diseases are transmitted, using simple examples to reach a wider local audience.

La fuerte relación que los residentes tienen con Río Doce, así como con sus inundaciones regulares, representan factores de exposición continua para el riesgo de enfermedades transmitidas por el agua. Este estudio examina la asociación entre la percepción de la contaminación y el uso del río, así como los mecanismos heurísticos usados en la formación de la percepción del riesgo. Se utilizó un modelo probit ordenado con variable instrumental y análisis de redes temáticas aplicadas a una base de datos primaria, representativa de los residentes de Tumiritinga, Minas Gerais, Brasil, para el año 2012. Los resultados indican que, aunque la mayoría de los residentes (92,6%) se dan cuenta del riesgo de contraer algún tipo de enfermedad, cuando se nada en Río Doce, sólo el 11,4% declara no entrar en el agua. El análisis de contenido sugiere que esta paradoja se debe a la falta de comprensión de la población de los mecanismos de transmisión de enfermedades hídricas, creándose un sesgo optimista sobre las posibilidades de contaminación.
Descritores: Exposição Ambiental/estatística & dados numéricos
Rios
Abastecimento de Água
Poluição Química da Água/estatística & dados numéricos
Doenças Transmitidas pela Água/transmissão
-Brasil
Exposição Ambiental/análise
Fatores de Risco
Fatores Socioeconômicos
Poluição Química da Água/análise
Doenças Transmitidas pela Água/classificação
Doenças Transmitidas pela Água/epidemiologia
Limites: Adolescente
Adulto
Idoso
Idoso de 80 Anos ou mais
Seres Humanos
Masculino
Meia-Idade
Adulto Jovem
Tipo de Publ: Research Support, Non-U.S. Gov't
Responsável: BR1.1 - BIREME


  10 / 21 LILACS  
              first record previous record
seleciona
para imprimir
Fotocópia
Texto completo
Id: lil-719717
Autor: Silva, Diego Ricardo Xavier.
Título: Variabilidade climática, vulnerabilidade ambiental e saúde: os níveis dorio Negro e as doenças relacionadas à água em Manaus / Climate variability, vulnerability and environmental health: levels of Negro river and water-related diseases in Manaus.
Fonte: Rio de Janeiro; s.n; 2014. xii,135 p. ilus, mapas, tab, graf.
Idioma: pt.
Tese: Apresentada a Fundação Oswaldo Cruz. Escola Nacional de Saúde Pública Sergio Arouca para obtenção do grau de Mestre.
Resumo: Manaus apresenta peculiaridades em relação às mudanças ambientais e climáticas. A sazonalidade das chuvas, níveis dos rios, produção de alimentos, pesca e condições de transporte condicionam a economia regional e influem sobre a vida na cidade. O nível da água do Rio Negro tem sido um regulador da dinâmica econômica e social da cidade, desde sua fundação. A persistência de casas de madeira construídas sobre palafitas é um exemplo de adaptação da população local à variabilidade climática. A altura das casas, pontes e trapiches sobre estacas revela uma conformação dos habitantes locais a variações esperadas do regime dos rios, ao mesmo tempo em que impõe um limite aceitável, além do qual torna-se inviável a moradia e as atividades econômicas, e consequentemente geram agravos a saúde. Nos últimos anos, o regime de cheias e vazantes tem superado as marcas históricas registradas. O objetivo desse trabalho foi analisar o comportamento hidrológico da região e relacionar seu impacto com agravos à saúde. Foi realizado um estudo de séries temporais que analisou as decomposições das séries para observação da tendência e sazonalidade. Na análise estatística utilizaram-se modelos aditivos generalizados (GAM). Os modelos multivariados também contemplaram variáveis metrológicas e Índices de Oscilação Niño (ONI). Com base nos resultados obtidos pelos modelos finais foram construídos cenários segundo a variação dos níveis do rio Negro na região de Manaus. Os resultados apontam uma associação entre eventos hidrológicos extremos e a incidência de algumas doenças na cidade. Por exemplo, cotas do rio acima de 28 metros em períodos de chuva apresentaram associação positiva com as notificações de casos de leptospirose. Os casos de febre tifoide apresentaram associação com defasagem de um mês em relação ao nível do rio Negro, temperatura máxima e índice ONI. Os casos de malária apresentaram associação com defasagem de 2 meses com a chuva e cotas acima 27,5 metros durante o período de subida do nível do rio Negro. Os resultados obtidos apontam para limiares do rio Negro na região de Manaus que podem direcionar intervenções, monitoramento, planejamento e medidas de adaptação de saúde no município.

Manaus has important specificities in the context of environmental and climate changes. Rainfall, the level of rivers, food production, the dynamic of fisheries, and transportation have a marked seasonal pattern, influencing regional economy and urban life. Rio Negro's water level has modulated the economic and social dynamics of the city since its inception. The persistence of wood houses built on stilts is an example of how the local population has adapted to climate variability over the years. The high height of the houses, the fact bridges and piers have been built on high wooden pillars document the way local inhabitants have did their best to face the challenges posed by the rivers' variable regimens. Despite all such flexibility, pronounced variations may exceed inhabitants' buffering initiatives, beyond a point housing and economic activities may be no longer viable. In consequence, social and health hazards may emerge. In recent years, the cycle of ebbs and flows has exceeded historical trademarks. This study analyzed the hydrology of the region and assessed its impact on health of the local population. Time series were fitted in order to discern their overall trends and seasonal patterns. Statistical analyses used generalized additive models (GAM). Multivariate models incorporated metrological data and the Niño Oscillation Index (ONI). Models' findings help to build scenarios focusing on the varying levels of the Rio Negro and their impact on the Manaus region. The results highlighted the association between extreme hydrological events and the incidence of different diseases in the city of Manaus.

For example, when the watermark is located 28 meters above the river's reference level, during the rainy season, cases of leptospirosis to the surveillance systems have increased. Cases of typhoid fever were found to be associated with a one-month lagged variation of Rio Negro, maximum temperatures and variations of the ONI index. Malaria cases were associated with a two-months lagged variation of rain and a watermark 27.5 meters above Rio Negro's reference level. Results helped to define the thresholds of Rio Negro in the Manaus region that may ask for targeted interventions, monitoring, planning, as well as to initiatives aiming to tailor health preservation to the actual conditions prevailing in the municipality.
Descritores: Clima
Mudança Climática
Diarreia/etiologia
Febre Tifoide/etiologia
Hepatite A/etiologia
Leptospirose/etiologia
Malária/etiologia
Rios
Doenças Transmitidas pela Água
-Fatores de Tempo
Limites: Seres Humanos
Tipo de Publ: Estudos de Validação
Responsável: BR526.1 - Biblioteca de Saúde Pública
BR526.1; T363.7098113, S586v



página 1 de 3 ir para página          
   


Refinar a pesquisa
  Base de dados : Formulário avançado   

    Pesquisar no campo  
1  
2
3
 
           



Search engine: iAH v2.6 powered by WWWISIS

BIREME/OPAS/OMS - Centro Latino-Americano e do Caribe de Informação em Ciências da Saúde