Base de dados : MEDLINE Pesquisa : D08.811.682.690 [Categoria DeCS] Referências encontradas : 7430 [refinar] Mostrando: 1 .. 10   no formato [Detalhado]

página 1 de 743

ir para página

1 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 29205772 [Au] Autor: Taher ES; Banwell MG; Buckler JN; Yan Q; Lan P [Ad] Endereço: Research School of Chemistry, Institute of Advanced Studies, The Australian National University, Canberra, ACT 2601, Australia. [Ti] Título: The Exploitation of Enzymatically-Derived cis-1,2-Dihydrocatechols and Related Compounds in the Synthesis of Biologically Active Natural Products. [So] Source: Chem Rec;18(2):239-264, 2018 Feb. [Is] ISSN: 1528-0691 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: The title compounds of the general form 1 can be produced at large scale and in essentially enantiomerically pure form (when X≠H) through the whole cell biotransformation of the corresponding aromatic. The "dense" and varied functionality associated with these metabolites mean that they have become increasingly useful chirons for the total synthesis of a range of natural product types. This personal account details the outcomes of a nearly three-decade long campaign within our group to exploit these compounds in the synthesis of a diverse range of small molecule natural product targets. The work is subdivided according to the key transformation(s) employed in each synthesis. The development of newer chirons that "complement" the utility of the cis-1,2-dihydrocatechols are also described. [Mh] Termos MeSH primário: Produtos Biológicos/metabolismo Catecóis/metabolismo Oxirredutases/metabolismo Oxigenases/metabolismo [Mh] Termos MeSH secundário: Produtos Biológicos/química Catecóis/química Estrutura Molecular [Pt] Tipo de publicação: JOURNAL ARTICLE; REVIEW [Nm] Nome de substância: 0 (Biological Products); 0 (Catechols); 0 (cis-1,2-dihydrocatechol); EC 1.- (Oxidoreductases); EC 1.13.- (Oxygenases); EC 1.14.12.11 (toluene dioxygenase) [Em] Mês de entrada: 1802 [Cu] Atualização por classe: 180227 [Lr] Data última revisão: 180227 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 171206 [St] Status: MEDLINE [do] DOI: 10.1002/tcr.201700064

2 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 29309888 [Au] Autor: Li Y; Fang J; Qi X; Lin M; Zhong Y; Sun L [Ad] Endereço: Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Zhengzhou 450009, PR China. [Ti] Título: A key structural gene, AaLDOX, is involved in anthocyanin biosynthesis in all red-fleshed kiwifruit (Actinidia arguta) based on transcriptome analysis. [So] Source: Gene;648:31-41, 2018 Mar 30. [Is] ISSN: 1879-0038 [Cp] País de publicação: Netherlands [La] Idioma: eng [Ab] Resumo: Study on kiwifruit (Actinidia chinensis and A. deliciosa) color mainly concentrated in green and yellow-fleshed cultivars, less about molecular mechanism of red-fleshed trait formation, rarely in all red-fleshed fruit. Using 'Tianyuanhong' and 'Yongfengyihao' ('TY', a kind of all red-fleshed cultivar, from Actinidia arguta; 'YF', a kind of all green-fleshed cultivar, also from Actinidia arguta) as experimental material, we performed RNA-seq to obtain 202,742 unigenes with an average length of 603bp and N50 of 873bp via transcriptome data analysis. Of these unigenes, 72,508 (35.76%) were annotated and 997 were assigned to secondary metabolic pathways, of which 104 unigenes were involved in flavonoid and anthocyanin biosynthesis. According to the parameter log2fold-change and p-adjusted, 12 differentially expressed structural genes were selected for performing expression profiles and cluster analysis. Physiological traits including color ration, hue angle, and anthocyanin content were also investigated. From the results, we concluded AaLDOX (genes encoding leucoanthocyanidin dioxygenase) maybe the key gene controlling anthocyanin biosynthesis in flesh of 'TY' kiwifruit, which promoted accumulation of anthocyanin, finally leading to the red flesh coloration. [Mh] Termos MeSH primário: Actinidia/genética Antocianinas/biossíntese Frutas/genética Perfilação da Expressão Gênica/métodos Oxigenases/genética Proteínas de Plantas/genética [Mh] Termos MeSH secundário: Actinidia/metabolismo Vias Biossintéticas/genética Frutas/metabolismo Regulação Enzimológica da Expressão Gênica Regulação da Expressão Gênica de Plantas Ontologia Genética Oxigenases/metabolismo Proteínas de Plantas/metabolismo [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (Anthocyanins); 0 (Plant Proteins); EC 1.13.- (Oxygenases); EC 1.14.11.- (leucoanthocyanidin dioxygenase) [Em] Mês de entrada: 1802 [Cu] Atualização por classe: 180226 [Lr] Data última revisão: 180226 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 180109 [St] Status: MEDLINE

3 / 7430

MEDLINE

seleciona para imprimir Fotocópia

[PMID]: 29364602 [Au] Autor: Danilova OV; Belova SE; Gagarinova IV; Dedysh SN [Ti] Título: Microbial Community Composition and Methanotroph Diversity of a Subarctic Wetland in Russia. [So] Source: Mikrobiologiia;85(5):545-554, 2016 Sep. [Is] ISSN: 0026-3656 [Cp] País de publicação: Russia (Federation) [La] Idioma: eng [Ab] Resumo: This study assessed the microbial diversity, activity, and composition of methane-oxidizing communities of a subarctic wetland in Russia,with mosaic cover of Sphagnum mosses and lichens of the genera Cladonia and Cetraria. Potential methane-oxidizing activity of peat sampled from lichen-dominated wetland sites was higher than that in the sites dominated by Sphagnum mosses. In peat from lichendominated sites, major bacterial groups identified by high-throughput sequencing of the 16S rRNA genes were the Acidobacteria (35.4-41.2% of total 16S rRNA gene reads), Alphaproteobacteria (19.1-24.2%), Gammaproteobacteria (7.9-11.1%), Actinobacteria (5.5-13.2%), Planctomycetes (7.2-9.5%), and Verrucomicrobia (5.1-9.5%). The distinctive feature of this community was high proportion of Subdivision 2 Acidobacteria, which are not char- acteristic for boreal Sphagnum peat bogs. Methanotrophic community composition was determined by mo- lecular analysis of the pmoA gene encoding particulate methane monooxygenase. Most (-80%) of all pmoA gene fragments revealed in peat from lichen-dominated sites belonged to the phylogenetic lineage represented by a microaerobic spiral-shaped methanotroph, "Candidatus Methylospira mobilis." Members of the genus Methylocystis, which are typical inhabitants of boreal Sphagnum peat bogs, represented only a minor group of indigenous methanotrophs. The specific feature of a methanotrophic community in peat from lichen-dominated sites was the presence of uncultivated USCa (Upland Soil Cluster alpha) methanotrophs, which are typical for acidic upland soils showing atmospheric methane oxidation. The methanotrophic community composition in lichen-dominated sites of a tundra wetland, therefore, was markedly different from that in bo- real Sphagnum peat bogs. [Mh] Termos MeSH primário: Proteínas de Bactérias/genética Água Subterrânea/microbiologia Metano/metabolismo Consórcios Microbianos/fisiologia Oxigenases/genética [Mh] Termos MeSH secundário: Acidobacteria/classificação Acidobacteria/genética Acidobacteria/isolamento & purificação Acidobacteria/metabolismo Actinobacteria/classificação Actinobacteria/genética Actinobacteria/isolamento & purificação Actinobacteria/metabolismo Alphaproteobacteria/classificação Alphaproteobacteria/genética Alphaproteobacteria/isolamento & purificação Alphaproteobacteria/metabolismo Regiões Árticas Proteínas de Bactérias/metabolismo Briófitas/fisiologia Gammaproteobacteria/classificação Gammaproteobacteria/genética Gammaproteobacteria/isolamento & purificação Gammaproteobacteria/metabolismo Expressão Gênica Líquens/fisiologia Metano/química Oxigenases/metabolismo Filogenia Planctomycetales/classificação Planctomycetales/genética Planctomycetales/isolamento & purificação Planctomycetales/metabolismo Federação Russa Verrucomicrobia/classificação Verrucomicrobia/genética Verrucomicrobia/isolamento & purificação Verrucomicrobia/metabolismo Zonas Úmidas [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (Bacterial Proteins); EC 1.13.- (Oxygenases); EC 1.14.13.25 (methane monooxygenase); OP0UW79H66 (Methane) [Em] Mês de entrada: 1802 [Cu] Atualização por classe: 180208 [Lr] Data última revisão: 180208 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 180125 [St] Status: MEDLINE

4 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 29291263 [Au] Autor: Giampieri F; Gasparrini M; Forbes-Hernandez TY; Mazzoni L; Capocasa F; Sabbadini S; Alvarez-Suarez JM; Afrin S; Rosati C; Pandolfini T; Molesini B; Sánchez-Sevilla JF; Amaya I; Mezzetti B; Battino M [Ti] Título: Overexpression of the Anthocyanidin Synthase Gene in Strawberry Enhances Antioxidant Capacity and Cytotoxic Effects on Human Hepatic Cancer Cells. [So] Source: J Agric Food Chem;66(3):581-592, 2018 Jan 24. [Is] ISSN: 1520-5118 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality. [Mh] Termos MeSH primário: Antioxidantes/análise Fragaria/enzimologia Frutas/química Neoplasias Hepáticas/tratamento farmacológico Oxigenases/genética Proteínas de Plantas/genética [Mh] Termos MeSH secundário: Antocianinas/análise Antocianinas/biossíntese Antocianinas/farmacologia Antioxidantes/metabolismo Antioxidantes/farmacologia Apoptose Fragaria/química Fragaria/genética Frutas/enzimologia Frutas/genética Células Hep G2 Seres Humanos Neoplasias Hepáticas/genética Neoplasias Hepáticas/metabolismo Neoplasias Hepáticas/fisiopatologia Mitocôndrias/efeitos dos fármacos Mitocôndrias/metabolismo Oxigenases/metabolismo Proteínas de Plantas/metabolismo Polifenóis/análise Polifenóis/metabolismo Polifenóis/farmacologia [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (Anthocyanins); 0 (Antioxidants); 0 (Plant Proteins); 0 (Polyphenols); EC 1.13.- (Oxygenases); EC 1.14.99.- (anthocyanidin synthase) [Em] Mês de entrada: 1802 [Cu] Atualização por classe: 180207 [Lr] Data última revisão: 180207 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 180102 [St] Status: MEDLINE [do] DOI: 10.1021/acs.jafc.7b04177

5 / 7430

MEDLINE

seleciona para imprimir Fotocópia

[PMID]: 27775357 [Au] Autor: Wang C; Zhao C; Hu L; Chen H [Ad] Endereço: Beijing National Laboratory for Molecular Sciences (BNLMS), CAS Key Laboratory of Photochemistry, Institute of Chemistry, Chinese Academy of Sciences , Beijing 100190, People's Republic of China. [Ti] Título: Calculated Mechanism of Cyanobacterial Aldehyde-Deformylating Oxygenase: Asymmetric Aldehyde Activation by a Symmetric Diiron Cofactor. [So] Source: J Phys Chem Lett;7(21):4427-4432, 2016 Nov 03. [Is] ISSN: 1948-7185 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: Cyanobacterial aldehyde-deformylating oxygenase (cADO) is a nonheme diiron enzyme that catalyzes the conversion of aldehyde to alk(a/e)ne, an important transformation in biofuel research. In this work, we report a highly desired computational study for probing the mechanism of cADO. By combining our QM/MM results with the available Fe Mössbauer spectroscopic data, the gained detailed structural information suggests construction of asymmetry from the symmetric diiron cofactor in an aldehyde substrate and O activation. His , one of the two iron-coordinate histidine residues in cADO, plays a pivotal role in this asymmetric aldehyde activation process by unprecedented reversible dissociation from the diiron cofactor, a behavior unknown in any other nonheme dinuclear or mononuclear enzymes. The revealed intrinsically asymmetric interactions of the substrate/O with the symmetric cofactor in cADO are inspirational for exploring diiron subsite resolution in other nonheme diiron enzymes. [Mh] Termos MeSH primário: Aldeídos/química Cianobactérias/química Oxigenases/química [Mh] Termos MeSH secundário: Catálise Oxirredução [Pt] Tipo de publicação: LETTER [Nm] Nome de substância: 0 (Aldehydes); EC 1.13.- (Oxygenases) [Em] Mês de entrada: 1802 [Cu] Atualização por classe: 180202 [Lr] Data última revisão: 180202 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 161104 [St] Status: MEDLINE

6 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 28981537 [Au] Autor: Mekonnen E; Bekele E [Ad] Endereço: Department of Microbial, Cellular, Molecular Biology, Addis Ababa University, Addis Ababa, Ethiopia. [Ti] Título: An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1. [So] Source: PLoS One;12(10):e0184931, 2017. [Is] ISSN: 1932-6203 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations. [Mh] Termos MeSH primário: Oxigenases/genética Polimorfismo de Nucleotídeo Único [Mh] Termos MeSH secundário: Estudos de Casos e Controles Etiópia Geografia Haplótipos Seres Humanos Desequilíbrio de Ligação Fenótipo [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: EC 1.13.- (Oxygenases); EC 1.14.13.8 (dimethylaniline monooxygenase (N-oxide forming)) [Em] Mês de entrada: 1710 [Cu] Atualização por classe: 171026 [Lr] Data última revisão: 171026 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 171006 [St] Status: MEDLINE [do] DOI: 10.1371/journal.pone.0184931

7 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 28935756 [Au] Autor: Trenteseaux C; Gaston AT; Aguesse A; Poupeau G; de Coppet P; Andriantsitohaina R; Laschet J; Amarger V; Krempf M; Nobecourt-Dupuy E; Ouguerram K [Ad] Endereço: From the UMR 1280 Physiopathologie des Adaptations Nutritionnelles, INRA, Université de Nantes, France (C.T., G.P., P.d.C., V.A., M.K., E.N.-D., K.O.); Centre de Recherche en Nutrition Humaine Ouest, Nantes, France (C.T., A.A., M.K., K.O.); UMR1063 Stress Oxydant et Pathologies Métaboliques, INSERM, [Ti] Título: Perinatal Hypercholesterolemia Exacerbates Atherosclerosis Lesions in Offspring by Altering Metabolism of Trimethylamine-N-Oxide and Bile Acids. [So] Source: Arterioscler Thromb Vasc Biol;37(11):2053-2063, 2017 Nov. [Is] ISSN: 1524-4636 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: OBJECTIVE: Experimental studies suggest that maternal hypercholesterolemia may be relevant for the early onset of cardiovascular disease in offspring. We investigated the effect of perinatal hypercholesterolemia on the atherosclerosis development in the offspring of apolipoprotein E-deficient mice and the underlying mechanism. APPROACH AND RESULTS: Atherosclerosis and related parameters were studied in adult male or female apolipoprotein E-deficient mice offspring from either normocholesterolemic or hypercholesterolemic mothers and normocholesterolemic fathers. Female born to hypercholesterolemic mothers had more aortic root lesions than female born to normocholesterolemic mothers. Lesions in whole aorta did not differ between groups. Higher trimethylamine-N-oxide levels and hepatic gene expression were higher in female born to hypercholesterolemic mothers offspring compared with female born to normocholesterolemic mothers and male. Trimethylamine-N-oxide levels were correlated with the size of atherosclerotic root lesions. Levels of hepatic cholesterol and gallbladder bile acid were greater in male born to hypercholesterolemic mothers compared with male born to normocholesterolemic mothers. At 18 weeks of age, female born to hypercholesterolemic mothers showed lower hepatic and but higher gene expression compared with female born to normocholesterolemic mothers. Male born to hypercholesterolemic mothers showed an increase in and gene expression compared with male born to normocholesterolemic mothers. At 25 weeks of age, female born to hypercholesterolemic mothers had lower gene expression compared with female born to normocholesterolemic mothers. DNA methylation of , and promoter regions was slightly modified and may explain the mRNA expression modulation. CONCLUSIONS: Our findings suggest that maternal hypercholesterolemia may exacerbate the development of atherosclerosis in female offspring by affecting metabolism of trimethylamine-N-oxide and bile acids. These data could be explained by epigenetic alterations. [Mh] Termos MeSH primário: Doenças da Aorta/metabolismo Aterosclerose/metabolismo Ácidos e Sais Biliares/metabolismo Hipercolesterolemia/metabolismo Metilaminas/metabolismo Efeitos Tardios da Exposição Pré-Natal [Mh] Termos MeSH secundário: Fatores Etários Animais Animais Recém-Nascidos Aorta/metabolismo Aorta/patologia Doenças da Aorta/etiologia Doenças da Aorta/genética Doenças da Aorta/patologia Apolipoproteínas E/deficiência Apolipoproteínas E/genética Aterosclerose/etiologia Aterosclerose/genética Aterosclerose/patologia Colesterol/metabolismo Colesterol 7-alfa-Hidroxilase/genética Colesterol 7-alfa-Hidroxilase/metabolismo Metilação de DNA Modelos Animais de Doenças Feminino Vesícula Biliar/metabolismo Predisposição Genética para Doença Hipercolesterolemia/complicações Hipercolesterolemia/genética Fígado/metabolismo Masculino Camundongos Knockout Oxigenases/genética Oxigenases/metabolismo Fenótipo Placa Aterosclerótica Gravidez Regiões Promotoras Genéticas Receptores Citoplasmáticos e Nucleares/genética Receptores Citoplasmáticos e Nucleares/metabolismo Receptores de LDL/genética Receptores de LDL/metabolismo Receptores Depuradores Classe B/genética Receptores Depuradores Classe B/metabolismo [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (Apolipoproteins E); 0 (Bile Acids and Salts); 0 (Methylamines); 0 (Receptors, Cytoplasmic and Nuclear); 0 (Receptors, LDL); 0 (Scarb1 protein, mouse); 0 (Scavenger Receptors, Class B); 0 (farnesoid X-activated receptor); 97C5T2UQ7J (Cholesterol); EC 1.13.- (Oxygenases); EC 1.14.13.8 (dimethylaniline monooxygenase (N-oxide forming)); EC 1.14.14.23 (Cholesterol 7-alpha-Hydroxylase); EC 1.14.14.23 (Cyp7a1 protein, mouse); FLD0K1SJ1A (trimethyloxamine) [Em] Mês de entrada: 1711 [Cu] Atualização por classe: 171107 [Lr] Data última revisão: 171107 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 170923 [St] Status: MEDLINE [do] DOI: 10.1161/ATVBAHA.117.309923

8 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 28844670 [Au] Autor: Zhong H; Luo Y; Sun J; Wang C; Wang QG; Gao GL; Zhang KS; Li Q; Wang HW; Li J; Chen MJ; Wang YM; Zhao XZ [Ad] Endereço: Chongqing Academy of Animal Sciences, Chongqing, PR China; Chongqing Engineering Research Center of Goose Genetic Improvement, Chongqing, PR China. [Ti] Título: Goose FMO3 gene cloning, tissue expression profiling, polymorphism detection and association analysis with trimethylamine level in the egg yolk. [So] Source: Gene;632:25-35, 2017 Oct 20. [Is] ISSN: 1879-0038 [Cp] País de publicação: Netherlands [La] Idioma: eng [Ab] Resumo: Flavin-containing monooxygenase 3 (FMO3) plays a critical role in catalyzing the conversion of trimethylamine (TMA) to trimethylamine-N-oxide (TMAO) in vivo. Despite the well-documented association between FMO3 mutations and a 'fishy' off-flavor eggs in chicken and quail, little information is available regarding the molecular characteristic of goose (Anser cygnoides) FMO3 and its relationship with the yolk TMA content. To fill these gaps, we cloned the full-length cDNA sequence of goose FMO3, which comprised 1851bp encoding 531 amino acids. FMO3 mRNA was dramatically expressed in liver than in other tissues in the geese. Eight single nucleotide polymorphisms (SNPs) were detected in the entire coding region. The CC genotype at the T669C site, GG at the A723G site, and AA at the G734A site of FMO3 were highly significantly associated with elevated TMA content in goose egg yolk (P<0.001). Carriers of the A allele of G734A or C allele of T885C had yolk TMA content that had a high probability of being elevated after feeding with additional choline chloride (P=0.0429, OR=4.1300, 95%CI=1.0390-16.4270, and P=0.0251, OR=4.6060, 95%CI=1.1620-18.2620, respectively). This work lays a foundation for studying the function of FMO3 and yolk TMA content in goose. However, studies using larger sample sizes and more goose breeds are required to determine whether the fishy off-flavor trait exists in goose. [Mh] Termos MeSH primário: Proteínas Aviárias/genética Gema de Ovo/metabolismo Gansos/genética Metilaminas/metabolismo Oxigenases/genética Polimorfismo Genético [Mh] Termos MeSH secundário: Animais Proteínas Aviárias/metabolismo Clonagem Molecular Ovos/análise Ovos/normas Mutação de Sentido Incorreto Oxigenases/metabolismo RNA Mensageiro/genética RNA Mensageiro/metabolismo [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (Avian Proteins); 0 (Methylamines); 0 (RNA, Messenger); EC 1.13.- (Oxygenases); EC 1.14.13.8 (dimethylaniline monooxygenase (N-oxide forming)); LHH7G8O305 (trimethylamine) [Em] Mês de entrada: 1710 [Cu] Atualização por classe: 171003 [Lr] Data última revisão: 171003 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 170829 [St] Status: MEDLINE

9 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 28823151 [Au] Autor: Komor AJ; Rivard BS; Fan R; Guo Y; Que L; Lipscomb JD [Ti] Título: CmlI N-Oxygenase Catalyzes the Final Three Steps in Chloramphenicol Biosynthesis without Dissociation of Intermediates. [So] Source: Biochemistry;56(37):4940-4950, 2017 Sep 19. [Is] ISSN: 1520-4995 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: CmlI catalyzes the six-electron oxidation of an aryl-amine precursor (NH -CAM) to the aryl-nitro group of chloramphenicol (CAM). The active site of CmlI contains a (hydr)oxo- and carboxylate-bridged dinuclear iron cluster. During catalysis, a novel diferric-peroxo intermediate P is formed and is thought to directly effect oxygenase chemistry. Peroxo intermediates can facilitate at most two-electron oxidations, so the biosynthetic pathway of CmlI must involve at least three steps. Here, kinetic techniques are used to characterize the rate and/or dissociation constants for each step by taking advantage of the remarkable stability of P in the absence of substrates (decay t = 3 h at 4 °C) and the visible chromophore of the diiron cluster. It is found that diferrous CmlI (CmlI ) can react with NH -CAM and O in either order to form a P-NH -CAM intermediate. P-NH -CAM undergoes rapid oxygen transfer to form a diferric CmlI (CmlI ) complex with the aryl-hydroxylamine [NH(OH)-CAM] pathway intermediate. CmlI -NH(OH)-CAM undergoes a rapid internal redox reaction to form a CmlI -nitroso-CAM (NO-CAM) complex. O binding results in formation of P-NO-CAM that converts to CmlI -CAM by enzyme-mediated oxygen atom transfer. The kinetic analysis indicates that there is little dissociation of pathway intermediates as the reaction progresses. Reactions initiated by adding pathway intermediates from solution occur much more slowly than those in which the intermediate is generated in the active site as part of the catalytic process. Thus, CmlI is able to preserve efficiency and specificity while avoiding adventitious chemistry by performing the entire six-electron oxidation in one active site. [Mh] Termos MeSH primário: Antibacterianos/biossíntese Proteínas de Bactérias/metabolismo Cloranfenicol/biossíntese Modelos Moleculares Ferroproteínas não Heme/metabolismo Oxigenases/metabolismo Streptomyces/enzimologia [Mh] Termos MeSH secundário: Antibacterianos/química Proteínas de Bactérias/química Biocatálise Domínio Catalítico Cloranfenicol/análogos & derivados Cloranfenicol/química Meia-Vida Cinética Ferroproteínas não Heme/química Oxirredução Oxigênio Oxigenases/química Espectroscopia de Mossbauer [Pt] Tipo de publicação: COMPARATIVE STUDY; JOURNAL ARTICLE [Nm] Nome de substância: 0 (Anti-Bacterial Agents); 0 (Bacterial Proteins); 0 (Nonheme Iron Proteins); 66974FR9Q1 (Chloramphenicol); EC 1.13.- (Oxygenases); S88TT14065 (Oxygen) [Em] Mês de entrada: 1710 [Cu] Atualização por classe: 171003 [Lr] Data última revisão: 171003 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 170822 [St] Status: MEDLINE [do] DOI: 10.1021/acs.biochem.7b00695

10 / 7430

MEDLINE

seleciona para imprimir Fotocópia Texto completo

[PMID]: 28819071 [Au] Autor: Xu M; Bhatt DK; Yeung CK; Claw KG; Chaudhry AS; Gaedigk A; Pearce RE; Broeckel U; Gaedigk R; Nickerson DA; Schuetz E; Rettie AE; Leeder JS; Thummel KE; Prasad B [Ad] Endereço: Departments of Pharmaceutics (M.X., D.K.B., K.G.C., K.E.T., B.P.), Medicinal Chemistry (C.K.Y., A.E.R.), and Genome Sciences (D.N.), University of Washington, Seattle, Washington; Department of Clinical Pharmacology, Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, Jiangsu, Ch [Ti] Título: Genetic and Nongenetic Factors Associated with Protein Abundance of Flavin-Containing Monooxygenase 3 in Human Liver. [So] Source: J Pharmacol Exp Ther;363(2):265-274, 2017 Nov. [Is] ISSN: 1521-0103 [Cp] País de publicação: United States [La] Idioma: eng [Ab] Resumo: Hepatic flavin-containing mono-oxygenase 3 (FMO3) metabolizes a broad array of nucleophilic heteroatom (e.g., or )-containing xenobiotics (e.g., amphetamine, sulindac, benzydamine, ranitidine, tamoxifen, nicotine, and ethionamide), as well as endogenous compounds (e.g., catecholamine and trimethylamine). To predict the effect of genetic and nongenetic factors on the hepatic metabolism of FMO3 substrates, we quantified FMO3 protein abundance in human liver microsomes (HLMs; = 445) by liquid chromatography-tandem mass chromatography proteomics. Genotyping/gene resequencing, mRNA expression, and functional activity (with benzydamine as probe substrate) of FMO3 were also evaluated. FMO3 abundance increased 2.2-fold (13.0 ± 11.4 pmol/mg protein vs. 28.0 ± 11.8 pmol/mg protein) from neonates to adults. After 6 years of age, no significant difference in FMO3 abundance was found between children and adults. Female donors exhibited modestly higher mRNA fragments per kilobase per million reads values (139.9 ± 76.9 vs. 105.1 ± 73.1; < 0.001) and protein FMO3 abundance (26.7 ± 12.0 pmol/mg protein vs. 24.1 ± 12.1 pmol/mg protein; < 0.05) compared with males. Six single nucleotide polymorphisms (SNPs), including rs2064074, rs28363536, rs2266782 (E158K), rs909530 (N285N), rs2266780 (E308G), and rs909531, were associated with significantly decreased protein abundance. FMO3 abundance in individuals homozygous and heterozygous for haplotype 3 (H3), representing variant alleles for all these SNPs (except rs2066534), were 50.8% ( < 0.001) and 79.5% ( < 0.01), respectively, of those with the reference homozygous haplotype (H1, representing wild-type). In summary, FMO3 protein abundance is significantly associated with age, gender, and genotype. These data are important in predicting FMO3-mediated heteroatom-oxidation of xenobiotics and endogenous biomolecules in the human liver. [Mh] Termos MeSH primário: Fígado/enzimologia Oxigenases/genética Oxigenases/metabolismo [Mh] Termos MeSH secundário: Adolescente Adulto Idoso Idoso de 80 Anos ou mais Envelhecimento/genética Envelhecimento/metabolismo Criança Pré-Escolar Estudos de Coortes Feminino Genótipo Seres Humanos Lactente Recém-Nascido Masculino Meia-Idade RNA Mensageiro/genética RNA Mensageiro/metabolismo Caracteres Sexuais Adulto Jovem [Pt] Tipo de publicação: JOURNAL ARTICLE [Nm] Nome de substância: 0 (RNA, Messenger); EC 1.13.- (Oxygenases); EC 1.14.13.8 (dimethylaniline monooxygenase (N-oxide forming)) [Em] Mês de entrada: 1711 [Cu] Atualização por classe: 171116 [Lr] Data última revisão: 171116 [Sb] Subgrupo de revista: IM [Da] Data de entrada para processamento: 170819 [St] Status: MEDLINE [do] DOI: 10.1124/jpet.117.243113

---

página 1 de 743

ir para página

Refinar a pesquisa

Base de dados : MEDLINE

Formulário avançado

		Pesquisar	no campo
1			PalavrasDescritor de assuntoDescritor de assunto primárioLimitesAutorPalavras do títuloPalavras do resumoIdiomaPaís de publicaçãoNome de substânciaNome de pessoa como assuntoRevistaAssunto de RevistaISSNTipo de publicaçãoIdentificador únicoMês de entradaAno de publicaçãoTexto completoAtualização por classeCategoria DeCSCategoria DeCS explodidaCategoria CID-10SubSetsPais de AfiliaçãoAfiliaçãoAfiliação 2
2	and or and not		PalavrasDescritor de assuntoDescritor de assunto primárioLimitesAutorPalavras do títuloPalavras do resumoIdiomaPaís de publicaçãoNome de substânciaNome de pessoa como assuntoRevistaAssunto de RevistaISSNTipo de publicaçãoIdentificador únicoMês de entradaAno de publicaçãoTexto completoAtualização por classeCategoria DeCSCategoria DeCS explodidaCategoria CID-10SubSetsPais de AfiliaçãoAfiliaçãoAfiliação 2
3	and or and not		PalavrasDescritor de assuntoDescritor de assunto primárioLimitesAutorPalavras do títuloPalavras do resumoIdiomaPaís de publicaçãoNome de substânciaNome de pessoa como assuntoRevistaAssunto de RevistaISSNTipo de publicaçãoIdentificador únicoMês de entradaAno de publicaçãoTexto completoAtualização por classeCategoria DeCSCategoria DeCS explodidaCategoria CID-10SubSetsPais de AfiliaçãoAfiliaçãoAfiliação 2

Search engine: iAH v2.6 powered by WWWISIS

BIREME/OPAS/OMS - Centro Latino-Americano e do Caribe de Informação em Ciências da Saúde