Base de dados : MEDLINE
Pesquisa : G05.390 [Categoria DeCS]
Referências encontradas : 1198 [refinar]
Mostrando: 1 .. 10   no formato [Detalhado]

página 1 de 120 ir para página                         

  1 / 1198 MEDLINE  
              next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:29202956
[Au] Autor:Bray MJ; Edwards TL; Wellons MF; Jones SH; Hartmann KE; Velez Edwards DR
[Ad] Endereço:Vanderbilt Genetics Institute, Vanderbilt University, Nashville, Tennessee.
[Ti] Título:Admixture mapping of uterine fibroid size and number in African American women.
[So] Source:Fertil Steril;108(6):1034-1042.e26, 2017 Dec.
[Is] ISSN:1556-5653
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:OBJECTIVE: To evaluate the relationship between genetic ancestry and uterine fibroid characteristics. DESIGN: Cross-sectional study. SETTING: Not applicable. PATIENT(S): A total of 609 African American participants with image- or surgery-confirmed fibroids in a biorepository at Vanderbilt University electronic health record biorepository and the Coronary Artery Risk Development in Young Adults studies were included. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Outcome measures include fibroid number (single vs. multiple), volume of largest fibroid, and largest fibroid dimension of all fibroid measurements. RESULT(S): Global ancestry meta-analyses revealed a significant inverse association between percentage of European ancestry and risk of multiple fibroids (odds ratio: 0.78; 95% confidence interval 0.66, 0.93; P=6.05 × 10 ). Local ancestry meta-analyses revealed five suggestive (P<4.80 × 10 ) admixture mapping peaks in 2q14.3-2q21.1, 3p14.2-3p14.1, 7q32.2-7q33, 10q21.1, 14q24.2-14q24.3, for number of fibroids and one suggestive admixture mapping peak (P<1.97 × 10 ) in 10q24.1-10q24.32 for volume of largest fibroid. Single variant association meta-analyses of the strongest associated region from admixture mapping of fibroid number (10q21.1) revealed a strong association at single nucleotide polymorphism variant rs12219990 (odds ratio: 0.41; 95% confidence interval 0.28, 0.60; P=3.82 × 10 ) that was significant after correction for multiple testing. CONCLUSION(S): Increasing African ancestry is associated with multiple fibroids but not with fibroid size. Local ancestry analyses identified several novel genomic regions not previously associated with fibroid number and increasing volume. Future studies are needed to explore the genetic impact that ancestry plays into the development of fibroid characteristics.
[Mh] Termos MeSH primário: Afroamericanos/genética
Biomarcadores Tumorais/genética
Leiomioma/genética
Leiomioma/patologia
Leiomiomatose/genética
Leiomiomatose/patologia
Carga Tumoral/genética
Neoplasias Uterinas/genética
Neoplasias Uterinas/patologia
[Mh] Termos MeSH secundário: Adulto
Bancos de Espécimes Biológicos
Estudos Transversais
Bases de Dados Factuais
Registros Eletrônicos de Saúde
Feminino
Predisposição Genética para Doença
Estudo de Associação Genômica Ampla
Hereditariedade
Seres Humanos
Leiomioma/etnologia
Leiomiomatose/etnologia
Modelos Lineares
Modelos Logísticos
Meia-Idade
Razão de Chances
Fenótipo
Polimorfismo de Nucleotídeo Único
Fatores de Risco
Estados Unidos/epidemiologia
Neoplasias Uterinas/etnologia
[Pt] Tipo de publicação:JOURNAL ARTICLE; META-ANALYSIS; MULTICENTER STUDY
[Nm] Nome de substância:
0 (Biomarkers, Tumor)
[Em] Mês de entrada:1712
[Cu] Atualização por classe:180307
[Lr] Data última revisão:
180307
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171206
[St] Status:MEDLINE


  2 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:27779103
[Au] Autor:Yang YC; Chang TY; Chen TC; Lin WS; Chang SC; Lee YJ
[Ad] Endereço:Department of Gynecology and Obstetrics, MacKay Memorial Hospital, Taipei City, Taiwan.
[Ti] Título:Functional variant of the P2X7 receptor gene is associated with human papillomavirus-16 positive cervical squamous cell carcinoma.
[So] Source:Oncotarget;7(50):82798-82803, 2016 Dec 13.
[Is] ISSN:1949-2553
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:Human papillomavirus (HPV) infection and the fate of HPV infected cervical epithelial cells are strictly associated with cervical cancer development. P2X7 receptor has been implicated in both the regulation of immune responses and apoptosis of cervical cancer cells. The study aims to investigate if polymorphisms in the P2RX7 gene are associated with the risk of cervical cancer in Taiwanese women. P2RX7 253 T/C, 835 G/A, and 1513 A/C loss-of-function polymorphisms were genotyped in a hospital-based study of 507 women with cervical squamous cell carcinoma (CSCC) and 1619 age-matched healthy control women. The presence and genotypes of HPV in CSCC was determined. The frequency of 253 C/C genotype was found to increase significantly in patients with HPV-16 positive CSCC compared with controls (odds ratio = 10.2, 95% confidence interval 1.39-87.8, Pc = 0.03). No significant associations were found for other 2 polymorphisms. Analysis of haplotypes also revealed no significant differences among women with CSCC, those with HPV-16 positive CSCC and controls. In conclusion, inheritance of the C/C genotype at position 253 in the P2RX7 gene may contribute to the risk of HPV-16 associated CSCC in Taiwanese women.
[Mh] Termos MeSH primário: Carcinoma de Células Escamosas/genética
DNA Viral/genética
Papillomavirus Humano 16/genética
Infecções por Papillomavirus/virologia
Polimorfismo de Nucleotídeo Único
Receptores Purinérgicos P2X7/genética
Neoplasias do Colo do Útero/genética
[Mh] Termos MeSH secundário: Adulto
Idoso
Carcinoma de Células Escamosas/patologia
Carcinoma de Células Escamosas/virologia
Estudos de Casos e Controles
Distribuição de Qui-Quadrado
Feminino
Frequência do Gene
Predisposição Genética para Doença
Haplótipos
Hereditariedade
Heterozigoto
Homozigoto
Testes de DNA para Papilomavírus Humano
Seres Humanos
Desequilíbrio de Ligação
Meia-Idade
Razão de Chances
Linhagem
Fenótipo
Fatores de Risco
Taiwan
Neoplasias do Colo do Útero/patologia
Neoplasias do Colo do Útero/virologia
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Nm] Nome de substância:
0 (DNA, Viral); 0 (P2XR receptor, human); 0 (Receptors, Purinergic P2X7)
[Em] Mês de entrada:1802
[Cu] Atualização por classe:180221
[Lr] Data última revisão:
180221
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:161026
[St] Status:MEDLINE
[do] DOI:10.18632/oncotarget.12636


  3 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
[PMID]:29224587
[Au] Autor:Madanat WY; Alawneh KM; Smadi MM; Saadeh SS; Omari MM; Bani Hani AB; Yazici H
[Ad] Endereço:Medical Department, Jordan's Friends of Behçet's Disease Patients Society, Amman, Jordan. wmadanat@orange.jo.
[Ti] Título:The prevalence of Behçet's disease in the north of Jordan: a hospital-based epidemiological survey.
[So] Source:Clin Exp Rheumatol;35 Suppl 108(6):51-54, 2017 Nov-Dec.
[Is] ISSN:0392-856X
[Cp] País de publicação:Italy
[La] Idioma:eng
[Ab] Resumo:OBJECTIVES: To estimate the prevalence of Behçet's disease (BD) in Jordan, with the additional aim of comparing this prevalence among hospital workers in other geographical areas. METHODS: In the first stage of our survey, 2,569 employees from 6 hospitals in north Jordan were interviewed using a screening questionnaire to identify individuals with recurrent oral ulcers (ROU), a previous diagnosis of BD (PDBD) and/or any major symptom related to BD. In the second stage, all individuals with ROU or PDBD identified at stage 1, were examined by 2 rheumatologists for the presence/confirmation of BD according to the International Study Group (ISG) criteria. Pathergy test was performed according to recommendations. RESULTS: ROU were present in 210 (8.2%) individuals. BD was confirmed in 10 employees with PDBD. Seven more BD patients were found. Mean age of 17 BD patients was 38.6±10.7 (range 26-65 y). M: F was 2.4:1. Pathergy test was positive in 8/17. A family history of ROU or BD was noted in 9 (52%) and 3 (25.0%), respectively, compared to 227 (8.9%) and 62 (2.6%) in the whole group, excluding the BD patients (p<0.001 and 0.008, respectively). The prevalence rate of BD in the north of Jordan was estimated as 66:10.000 (95% CI 34.8 to 97.5:10000). CONCLUSIONS: The results of this first ever survey indicated that the prevalence of BD in the north of Jordan is among the highest in the world. This prevalence can now be compared to hospital workers in other geographical areas.
[Mh] Termos MeSH primário: Síndrome de Behçet/epidemiologia
Hospitais
Úlceras Orais/epidemiologia
Recursos Humanos em Hospital
[Mh] Termos MeSH secundário: Adulto
Idoso
Síndrome de Behçet/diagnóstico
Síndrome de Behçet/genética
Feminino
Predisposição Genética para Doença
Inquéritos Epidemiológicos
Hereditariedade
Seres Humanos
Jordânia/epidemiologia
Masculino
Meia-Idade
Úlceras Orais/diagnóstico
Úlceras Orais/genética
Linhagem
Prevalência
Recidiva
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Em] Mês de entrada:1802
[Cu] Atualização por classe:180213
[Lr] Data última revisão:
180213
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171212
[St] Status:MEDLINE


  4 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:29267281
[Au] Autor:Flint J
[Ad] Endereço:Center for Neurobehavioral Genetics, University of California Los Angeles, Los Angeles, California, United States of America.
[Ti] Título:Deep Reads: How I learnt to love population genetics.
[So] Source:PLoS Genet;13(12):e1007140, 2017 12.
[Is] ISSN:1553-7404
[Cp] País de publicação:United States
[La] Idioma:eng
[Mh] Termos MeSH primário: Genética Populacional
Hereditariedade/genética
Locos de Características Quantitativas/genética
[Mh] Termos MeSH secundário: Animais
Criança
Loci Gênicos
Seres Humanos
Camundongos
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Em] Mês de entrada:1801
[Cu] Atualização por classe:180111
[Lr] Data última revisão:
180111
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171222
[St] Status:MEDLINE
[do] DOI:10.1371/journal.pgen.1007140


  5 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:29174219
[Au] Autor:Prudente S; Ludovico O; Trischitta V
[Ad] Endereço:Research Unit of Metabolic and Cardiovascular Diseases, IRCCS Casa Sollievo della Sofferenza, San Giovanni Rotondo, Italy. Electronic address: s.prudente@css-mendel.it.
[Ti] Título:Familial diabetes of adulthood: A bin of ignorance that needs to be addressed.
[So] Source:Nutr Metab Cardiovasc Dis;27(12):1053-1059, 2017 Dec.
[Is] ISSN:1590-3729
[Cp] País de publicação:Netherlands
[La] Idioma:eng
[Ab] Resumo:AIMS: The aim of this article was to share with a wide readership some data and related reasoning about a multigenerational form of diabetes mellitus of adulthood. DATA SYNTHESIS: We have recently described a familial form of diabetes mellitus, which in the routine clinical setting of adult individuals is simplistically diagnosed as type 2 diabetes. Such misdiagnosis involves as much as 3% of adult unrelated diabetic patients with no evidence of autoimmune disease. More recent data, obtained by means of a next-generation sequencing, indicate that approximately 25% of such patients carry mutations in the genes involved in monogenic diabetes, thus leaving unraveled the molecular causes of the remaining 75% individuals. CONCLUSIONS: Our proposal is to define the latter patients as being affected by familial diabetes of adulthood (FDA), a clear admission of ignorance and a limbo where adult patients with multigenerational diabetes with no genetic definition of their hyperglycemia have to wait for better times.
[Mh] Termos MeSH primário: Glicemia/genética
Diabetes Mellitus Tipo 2/genética
Mutação
[Mh] Termos MeSH secundário: Biomarcadores/sangue
Glicemia/metabolismo
Análise Mutacional de DNA
Diabetes Mellitus Tipo 2/sangue
Diabetes Mellitus Tipo 2/diagnóstico
Erros de Diagnóstico
Marcadores Genéticos
Predisposição Genética para Doença
Hereditariedade
Seres Humanos
Técnicas de Diagnóstico Molecular
Linhagem
Fenótipo
Valor Preditivo dos Testes
Fatores de Risco
[Pt] Tipo de publicação:JOURNAL ARTICLE; REVIEW
[Nm] Nome de substância:
0 (Biomarkers); 0 (Blood Glucose); 0 (Genetic Markers)
[Em] Mês de entrada:1712
[Cu] Atualização por classe:171218
[Lr] Data última revisão:
171218
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171128
[St] Status:MEDLINE


  6 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:29100090
[Au] Autor:Sanna-Cherchi S; Khan K; Westland R; Krithivasan P; Fievet L; Rasouly HM; Ionita-Laza I; Capone VP; Fasel DA; Kiryluk K; Kamalakaran S; Bodria M; Otto EA; Sampson MG; Gillies CE; Vega-Warner V; Vukojevic K; Pediaditakis I; Makar GS; Mitrotti A; Verbitsky M; Martino J; Liu Q; Na YJ; Goj V; Ardissino G; Gigante M; Gesualdo L; Janezcko M; Zaniew M; Mendelsohn CL; Shril S; Hildebrandt F; van Wijk JAE; Arapovic A; Saraga M; Allegri L; Izzi C; Scolari F; Tasic V; Ghiggeri GM; Latos-Bielenska A; Materna-Kiryluk A; Mane S; Goldstein DB; Lifton RP; Katsanis N; Davis EE; Gharavi AG
[Ad] Endereço:Division of Nephrology, Columbia University, New York, NY 10032, USA. Electronic address: ss2517@cumc.columbia.edu.
[Ti] Título:Exome-wide Association Study Identifies GREB1L Mutations in Congenital Kidney Malformations.
[So] Source:Am J Hum Genet;101(5):789-802, 2017 Nov 02.
[Is] ISSN:1537-6605
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:Renal agenesis and hypodysplasia (RHD) are major causes of pediatric chronic kidney disease and are highly genetically heterogeneous. We conducted whole-exome sequencing in 202 case subjects with RHD and identified diagnostic mutations in genes known to be associated with RHD in 7/202 case subjects. In an additional affected individual with RHD and a congenital heart defect, we found a homozygous loss-of-function (LOF) variant in SLIT3, recapitulating phenotypes reported with Slit3 inactivation in the mouse. To identify genes associated with RHD, we performed an exome-wide association study with 195 unresolved case subjects and 6,905 control subjects. The top signal resided in GREB1L, a gene implicated previously in Hoxb1 and Shha signaling in zebrafish. The significance of the association, which was p = 2.0 × 10 for novel LOF, increased to p = 4.1 × 10 for LOF and deleterious missense variants combined, and augmented further after accounting for segregation and de novo inheritance of rare variants (joint p = 2.3 × 10 ). Finally, CRISPR/Cas9 disruption or knockdown of greb1l in zebrafish caused specific pronephric defects, which were rescued by wild-type human GREB1L mRNA, but not mRNA containing alleles identified in case subjects. Together, our study provides insight into the genetic landscape of kidney malformations in humans, presents multiple candidates, and identifies SLIT3 and GREB1L as genes implicated in the pathogenesis of RHD.
[Mh] Termos MeSH primário: Anormalidades Congênitas/genética
Exoma/genética
Nefropatias/congênito
Rim/anormalidades
Mutação/genética
Proteínas de Neoplasias/genética
[Mh] Termos MeSH secundário: Alelos
Animais
Estudos de Casos e Controles
Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas/genética
Feminino
Heterogeneidade Genética
Estudo de Associação Genômica Ampla/métodos
Genótipo
Hereditariedade/genética
Homozigoto
Seres Humanos
Nefropatias/genética
Masculino
Proteínas de Membrana/genética
Camundongos
Fenótipo
RNA Longo não Codificante/genética
Sistema Urinário/anormalidades
Anormalidades Urogenitais/genética
Peixe-Zebra
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Nm] Nome de substância:
0 (GREB1 protein, human); 0 (Membrane Proteins); 0 (Neoplasm Proteins); 0 (RNA, Long Noncoding)
[Em] Mês de entrada:1711
[Cu] Atualização por classe:171121
[Lr] Data última revisão:
171121
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171104
[St] Status:MEDLINE


  7 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:29038103
[Au] Autor:Pilichou K; Lazzarini E; Rigato I; Celeghin R; De Bortoli M; Perazzolo Marra M; Cason M; Jongbloed J; Calore M; Rizzo S; Regazzo D; Poloni G; Iliceto S; Daliento L; Delise P; Corrado D; Van Tintelen JP; Thiene G; Rampazzo A; Basso C; Bauce B; Lorenzon A; Occhi G
[Ad] Endereço:From the Departments of Cardiac, Thoracic, and Vascular Sciences (K.P., E.L., I.R., R.C., M.P.M., M.C., S.R., S.I., L.D., D.C., G. T., C.B., B.B.) and Medicine (D.R.), University of Padua, Italy; Department of Biology, University of Padua, Italy (M.D.B., M.C., G.P., A.R., A.L., G.O.); University Med
[Ti] Título:Large Genomic Rearrangements of Desmosomal Genes in Italian Arrhythmogenic Cardiomyopathy Patients.
[So] Source:Circ Arrhythm Electrophysiol;10(10), 2017 Oct.
[Is] ISSN:1941-3084
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:BACKGROUND: Arrhythmogenic cardiomyopathy (AC) is an inherited heart muscle disease associated with point mutations in genes encoding for cardiac desmosome proteins. Conventional mutation screening is positive in ≈50% of probands. Copy number variations (CNVs) have recently been linked to AC pointing to the need to determine the prevalence of CNVs in desmosomal genes and to evaluate disease penetrance by cosegregation analysis in family members. METHODS AND RESULTS: A total of 160 AC genotype-negative probands for 5 AC desmosomal genes by conventional mutation screening underwent multiplex ligation-dependent probe amplification. Nine heterozygous CNVs were identified in 11 (6.9%) of the 160 probands. Five carried a deletion of the entire plakophilin-2 ( ) gene, 2 a deletion of only exon 4, 1 a deletion of the exons 6 to 11, 1 a duplication of 5' untranslated region till exon 1, 1 the desmocollin-2 ( ) duplication of exons 7 to 9, and 1 a large deletion of chromosome 18 comprising both and genes. All probands were affected by moderate-severe forms of the disease, whereas 10 (32%) of the 31 family members carrying one of these deletions fulfilled the diagnostic criteria. CONCLUSIONS: Genomic rearrangements were detected in ≈7% of AC probands negative for pathogenic point mutations in desmosomal genes, highlighting the potential of CNVs analysis to substantially increase the diagnostic yield of genetic testing. Genotype-phenotype correlation demonstrated the presence of the disease in about one third of family members carrying the CNV, underlying the role of other factors in the development and progression of the disease.
[Mh] Termos MeSH primário: Displasia Arritmogênica Ventricular Direita/genética
Desmossomos/genética
Rearranjo Gênico
[Mh] Termos MeSH secundário: Potenciais de Ação
Adolescente
Adulto
Idoso
Displasia Arritmogênica Ventricular Direita/diagnóstico
Displasia Arritmogênica Ventricular Direita/fisiopatologia
Variações do Número de Cópias de DNA
Análise Mutacional de DNA
Desmocolinas/genética
Desmogleína 2/genética
Desmoplaquinas/genética
Eletrocardiografia
Técnicas Eletrofisiológicas Cardíacas
Feminino
Deleção de Genes
Dosagem de Genes
Duplicação Gênica
Estudos de Associação Genética
Marcadores Genéticos
Predisposição Genética para Doença
Frequência Cardíaca
Hereditariedade
Seres Humanos
Itália
Masculino
Meia-Idade
Reação em Cadeia da Polimerase Multiplex
Linhagem
Fenótipo
Placofilinas/genética
Mutação Puntual
Fatores de Risco
Adulto Jovem
gama Catenina
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Nm] Nome de substância:
0 (DSC2 protein, human); 0 (DSG2 protein, human); 0 (DSP protein, human); 0 (Desmocollins); 0 (Desmoglein 2); 0 (Desmoplakins); 0 (Genetic Markers); 0 (JUP protein, human); 0 (PKP2 protein, human); 0 (Plakophilins); 0 (gamma Catenin)
[Em] Mês de entrada:1710
[Cu] Atualização por classe:171116
[Lr] Data última revisão:
171116
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:171018
[St] Status:MEDLINE


  8 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:28986664
[Au] Autor:Zhao ZY; Jiang YL; Li BR; Yang F; Li J; Jin XW; Ning SB; Sun SH
[Ad] Endereço:Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd., Shanghai, 200433, China.
[Ti] Título:A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.
[So] Source:Dig Dis Sci;62(11):3014-3020, 2017 Nov.
[Is] ISSN:1573-2568
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
[Mh] Termos MeSH primário: Biomarcadores Tumorais/genética
Síndrome de Peutz-Jeghers/genética
Proteínas Serina-Treonina Quinases/genética
Deleção de Sequência
[Mh] Termos MeSH secundário: Adulto
Grupo com Ancestrais do Continente Asiático/genética
Sequência de Bases
Biomarcadores Tumorais/química
Biomarcadores Tumorais/metabolismo
China
Análise Mutacional de DNA
Éxons
Feminino
Predisposição Genética para Doença
Hereditariedade
Heterozigoto
Seres Humanos
Modelos Moleculares
Linhagem
Síndrome de Peutz-Jeghers/diagnóstico
Síndrome de Peutz-Jeghers/enzimologia
Síndrome de Peutz-Jeghers/etnologia
Fenótipo
Conformação Proteica
Proteínas Serina-Treonina Quinases/química
Proteínas Serina-Treonina Quinases/metabolismo
Relação Estrutura-Atividade
[Pt] Tipo de publicação:CASE REPORTS; JOURNAL ARTICLE
[Nm] Nome de substância:
0 (Biomarkers, Tumor); EC 2.7.1.- (STK11 protein, human); EC 2.7.11.1 (Protein-Serine-Threonine Kinases)
[Em] Mês de entrada:1711
[Cu] Atualização por classe:171106
[Lr] Data última revisão:
171106
[Sb] Subgrupo de revista:AIM; IM
[Da] Data de entrada para processamento:171008
[St] Status:MEDLINE
[do] DOI:10.1007/s10620-017-4741-5


  9 / 1198 MEDLINE  
              first record previous record next record last record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:28886475
[Au] Autor:Phi XA; Houssami N; Hooning MJ; Riedl CC; Leach MO; Sardanelli F; Warner E; Trop I; Saadatmand S; Tilanus-Linthorst MMA; Helbich TH; van den Heuvel ER; de Koning HJ; Obdeijn IM; de Bock GH
[Ad] Endereço:Department of Epidemiology, University of Groningen, University Medical Center Groningen, Postbus 30 001, 9700RB, Groningen, The Netherlands. Electronic address: x.a.phi@umcg.nl.
[Ti] Título:Accuracy of screening women at familial risk of breast cancer without a known gene mutation: Individual patient data meta-analysis.
[So] Source:Eur J Cancer;85:31-38, 2017 Nov.
[Is] ISSN:1879-0852
[Cp] País de publicação:England
[La] Idioma:eng
[Ab] Resumo:INTRODUCTION: Women with a strong family history of breast cancer (BC) and without a known gene mutation have an increased risk of developing BC. We aimed to investigate the accuracy of screening using annual mammography with or without magnetic resonance imaging (MRI) for these women outside the general population screening program. METHODS: An individual patient data (IPD) meta-analysis was conducted using IPD from six prospective screening trials that had included women at increased risk for BC: only women with a strong familial risk for BC and without a known gene mutation were included in this analysis. A generalised linear mixed model was applied to estimate and compare screening accuracy (sensitivity, specificity and predictive values) for annual mammography with or without MRI. RESULTS: There were 2226 women (median age: 41 years, interquartile range 35-47) with 7478 woman-years of follow-up, with a BC rate of 12 (95% confidence interval 9.3-14) in 1000 woman-years. Mammography screening had a sensitivity of 55% (standard error of mean [SE] 7.0) and a specificity of 94% (SE 1.3). Screening with MRI alone had a sensitivity of 89% (SE 4.6) and a specificity of 83% (SE 2.8). Adding MRI to mammography increased sensitivity to 98% (SE 1.8, P < 0.01 compared to mammography alone) but lowered specificity to 79% (SE 2.7, P < 0.01 compared with mammography alone). CONCLUSION: In this population of women with strong familial BC risk but without a known gene mutation, in whom BC incidence was high both before and after age 50, adding MRI to mammography substantially increased screening sensitivity but also decreased its specificity.
[Mh] Termos MeSH primário: Biomarcadores Tumorais/genética
Neoplasias da Mama/diagnóstico por imagem
Neoplasias da Mama/genética
Detecção Precoce de Câncer/métodos
Imagem por Ressonância Magnética
Mamografia
Mutação
[Mh] Termos MeSH secundário: Adulto
Neoplasias da Mama/epidemiologia
Ensaios Clínicos como Assunto
Análise Mutacional de DNA
Feminino
Predisposição Genética para Doença
Hereditariedade
Seres Humanos
Meia-Idade
Linhagem
Fenótipo
Valor Preditivo dos Testes
Reprodutibilidade dos Testes
Medição de Risco
Fatores de Risco
[Pt] Tipo de publicação:JOURNAL ARTICLE; META-ANALYSIS; REVIEW
[Nm] Nome de substância:
0 (Biomarkers, Tumor)
[Em] Mês de entrada:1710
[Cu] Atualização por classe:171023
[Lr] Data última revisão:
171023
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:170909
[St] Status:MEDLINE


  10 / 1198 MEDLINE  
              first record previous record
seleciona
para imprimir
Fotocópia
Texto completo
[PMID]:28882873
[Au] Autor:Trigueros-Motos L; van Capelleveen JC; Torta F; Castaño D; Zhang LH; Chai EC; Kang M; Dimova LG; Schimmel AWM; Tietjen I; Radomski C; Tan LJ; Thiam CH; Narayanaswamy P; Wu DH; Dorninger F; Yakala GK; Barhdadi A; Angeli V; Dubé MP; Berger J; Dallinga-Thie GM; Tietge UJF; Wenk MR; Hayden MR; Hovingh GK; Singaraja RR
[Ad] Endereço:From the Translational Laboratory in Genetic Medicine, A*STAR Institute, and Yong Loo Lin School of Medicine, National University of Singapore (L.T.-M., D.C., E.C.C., L.J.T., D.H.W., G.K.Y., M.R.H., R.R.S.); Departments of Vascular Medicine and Experimental Vascular Medicine, Academic Medical Centre
[Ti] Título:ABCA8 Regulates Cholesterol Efflux and High-Density Lipoprotein Cholesterol Levels.
[So] Source:Arterioscler Thromb Vasc Biol;37(11):2147-2155, 2017 Nov.
[Is] ISSN:1524-4636
[Cp] País de publicação:United States
[La] Idioma:eng
[Ab] Resumo:OBJECTIVE: High-density lipoproteins (HDL) are considered to protect against atherosclerosis in part by facilitating the removal of cholesterol from peripheral tissues. However, factors regulating lipid efflux are incompletely understood. We previously identified a variant in adenosine triphosphate-binding cassette transporter A8 ( ) in an individual with low HDL cholesterol (HDLc). Here, we investigate the role of ABCA8 in cholesterol efflux and in regulating HDLc levels. APPROACH AND RESULTS: We sequenced in individuals with low and high HDLc and identified, exclusively in low HDLc probands, 3 predicted deleterious heterozygous mutations (p.Pro609Arg [P609R], IVS17-2 A>G and p.Thr741Stop [T741X]). HDLc levels were lower in heterozygous mutation carriers compared with first-degree family controls (0.86±0.34 versus 1.17±0.26 mmol/L; =0.005). HDLc levels were significantly decreased by 29% ( =0.01) in mice on a high-cholesterol diet compared with wild-type mice, whereas hepatic overexpression of human in mice resulted in significant increases in plasma HDLc and the first steps of macrophage-to-feces reverse cholesterol transport. Overexpression of wild-type but not mutant ABCA8 resulted in a significant increase (1.8-fold; =0.01) of cholesterol efflux to apolipoprotein AI in vitro. ABCA8 colocalizes and interacts with adenosine triphosphate-binding cassette transporter A1 and further potentiates adenosine triphosphate-binding cassette transporter A1-mediated cholesterol efflux. CONCLUSIONS: ABCA8 facilitates cholesterol efflux and modulates HDLc levels in humans and mice.
[Mh] Termos MeSH primário: Transportadores de Cassetes de Ligação de ATP/metabolismo
Colesterol na Dieta/sangue
HDL-Colesterol/sangue
[Mh] Termos MeSH secundário: Transportadores de Cassetes de Ligação de ATP/deficiência
Transportadores de Cassetes de Ligação de ATP/genética
Adulto
Idoso
Animais
Apolipoproteína A-I/sangue
Apolipoproteína B-100/sangue
Transporte Biológico
Biomarcadores/sangue
Células COS
Estudos de Casos e Controles
Cercopithecus aethiops
Análise Mutacional de DNA
Dieta Hiperlipídica
Fezes/química
Feminino
Células HEK293
Hereditariedade
Heterozigoto
Seres Humanos
Fígado/metabolismo
Macrófagos/metabolismo
Masculino
Camundongos Endogâmicos C57BL
Camundongos Knockout
Meia-Idade
Mutação
Linhagem
Fenótipo
Transfecção
[Pt] Tipo de publicação:JOURNAL ARTICLE
[Nm] Nome de substância:
0 (ABCA8 protein, human); 0 (APOA1 protein, human); 0 (APOB protein, human); 0 (Abca8b protein, mouse); 0 (Apolipoprotein A-I); 0 (Apolipoprotein B-100); 0 (Biomarkers); 0 (Cholesterol, Dietary); 0 (Cholesterol, HDL)
[Em] Mês de entrada:1711
[Cu] Atualização por classe:171107
[Lr] Data última revisão:
171107
[Sb] Subgrupo de revista:IM
[Da] Data de entrada para processamento:170909
[St] Status:MEDLINE
[do] DOI:10.1161/ATVBAHA.117.309574



página 1 de 120 ir para página                         
   


Refinar a pesquisa
  Base de dados : MEDLINE Formulário avançado   

    Pesquisar no campo  
1  
2
3
 
           



Search engine: iAH v2.6 powered by WWWISIS

BIREME/OPAS/OMS - Centro Latino-Americano e do Caribe de Informação em Ciências da Saúde